Repertoire Analysis of the Detected Clonotype

The 'TRUST4' or 'MiXCR' is used to identify the clonotypes. The goal of 'rTCRBCRr' is to process the results from these clonotyping tools, and analyze the clonotype repertoire metrics based on chain names and IGH isotypes. The manuscript is still under preparation for publication for now. The references describing the methods in this package will be added later.


R R-CMD-check

rTCRBCRr

The goal of rTCRBCRr is to process the results from clonotyping tools such as trust, mixcr, and immunoseq to analyze the clonotype repertoire metrics

Installation

The package is accepted by the CRAN, you can install the released version of rTCRBCRr from CRAN with:

install.packages("rTCRBCRr")

You can also install the development version from GitHub with:

# install.packages("devtools")
devtools::install_github("sciencepeak/rTCRBCRr")

Example code

Attach packages

library("rTCRBCRr")
library("magrittr")
library("readr")

Read raw data files (trust generated for example) into a list of data frames

present_tool <- c("trust", "mixcr")[1]
example_data_directory <- system.file(paste("extdata", present_tool, sep = "/"), package = "rTCRBCRr")
input_paths <- dir(example_data_directory, full.names = TRUE)
input_files <- dir(example_data_directory, full.names = FALSE)
input_files
#> [1] "sample_01.tsv.bz2" "sample_02.tsv.bz2" "sample_03.tsv.bz2"

sample_names <- sub(".tsv.*", "", input_files)
sample_names
#> [1] "sample_01" "sample_02" "sample_03"

raw_clonotype_dataframe_list <- lapply(input_paths, readr::read_tsv) %>%
    magrittr::set_names(., value = sample_names)
raw_clonotype_dataframe_list
#> $sample_01
#> # A tibble: 5,051 x 10
#>    `#count` frequency CDR3nt                CDR3aa V     D     J     C     cid  
#>       <dbl>     <dbl> <chr>                 <chr>  <chr> <chr> <chr> <chr> <chr>
#>  1     1813    0.0664 TGTCAGAAGTATGGTGGCTC~ CQKYG~ IGKV~ .     IGKJ~ IGKC  asse~
#>  2     1684    0.0833 TGCGCGAGAGATGCGGGGGG~ CARDA~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#>  3     1648    0.0815 TGTGCGAGAGGGGGAGTGGA~ CARGG~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#>  4     1505    0.0551 TGTCAACAGCTTAGTTATTA~ CQQLS~ IGKV~ .     IGKJ~ IGKC  asse~
#>  5     1081    0.0396 TGCATGCAAGGTCTACAAAC~ CMQGL~ IGKV~ .     IGKJ~ IGKC  asse~
#>  6      895    0.0328 TGTCAACAGAGTTACGGTAC~ CQQSY~ IGKV~ .     IGKJ~ IGKC  asse~
#>  7      866    0.0429 TGTGCGAGAGCCTCTTATTA~ CARAS~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#>  8      811    0.0297 TGCATGCAAGCTCTACAAAC~ CMQAL~ IGKV~ .     IGKJ~ IGKC  asse~
#>  9      767    0.0281 TGCTGCTCATATACAGGCAG~ CCSYT~ IGLV~ .     IGLJ~ IGLC  asse~
#> 10      761    0.0377 TGTGCTAGGGCGGCCAGTGG~ CARAA~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#> # ... with 5,041 more rows, and 1 more variable: cid_full_length <dbl>
#> 
#> $sample_02
#> # A tibble: 5,915 x 10
#>    `#count` frequency CDR3nt                CDR3aa V     D     J     C     cid  
#>       <dbl>     <dbl> <chr>                 <chr>  <chr> <chr> <chr> <chr> <chr>
#>  1     5392    0.0875 TGCATGCAAGCTCTACAAAC~ CMQAL~ IGKV~ .     IGKJ~ IGKC  asse~
#>  2     4470    0.0725 TGCATGCAATCTCTACAAGC~ CMQSL~ IGKV~ .     IGKJ~ IGKC  asse~
#>  3     3852    0.0625 TGTCAGCAGTATAATAACTG~ CQQYN~ IGKV~ .     IGKJ~ IGKC  asse~
#>  4     2893    0.0470 TGCCAACGATATGATACTTA~ CQRYD~ IGKV~ .     IGKJ~ IGKC  asse~
#>  5     2698    0.0438 TGTCAGCAGTATAATAACTG~ CQQYN~ IGKV~ .     IGKJ~ IGKC  asse~
#>  6     1691    0.0509 TGTGCGAGACAAGTTCGTCC~ CARQV~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#>  7     1589    0.0478 TGTGCGAGACACGCGGATAC~ CARHA~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#>  8     1373    0.0414 TGTGCGAGACAGTTTTACTA~ CARQF~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#>  9     1319    0.0397 TGTGCGGCAGAGTGGGCTAG~ CAAEW~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#> 10     1172    0.0353 TGTGCGAGGGGGGTCAATTA~ CARGV~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#> # ... with 5,905 more rows, and 1 more variable: cid_full_length <dbl>
#> 
#> $sample_03
#> # A tibble: 6,027 x 10
#>    `#count` frequency CDR3nt                CDR3aa V     D     J     C     cid  
#>       <dbl>     <dbl> <chr>                 <chr>  <chr> <chr> <chr> <chr> <chr>
#>  1    14711    0.335  TGTACACTCCTGGTGACCAC~ CTLLV~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#>  2    13909    0.341  TGCCAGTCCTATGACAGCAG~ CQSYD~ IGLV~ .     IGLJ~ IGLC  asse~
#>  3     6790    0.166  TGCAGCTCACACACAAGCAG~ CSSHT~ IGLV~ .     IGLJ~ IGLC  asse~
#>  4     4209    0.0959 TGTGCGAGAGCCCTCCCCTA~ CARAL~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#>  5     3727    0.0850 TGTGCGAGAGCCCTCCCCTA~ CARAL~ IGHV~ IGHD~ IGHJ~ IGHA1 asse~
#>  6      910    0.0223 TGCAGCTCATATGCAGGCGG~ CSSYA~ IGLV~ .     IGLJ~ IGLC  asse~
#>  7      771    0.0189 TGTGCAGCATGGGAAGACAG~ CAAWE~ IGLV~ .     IGLJ~ IGLC  asse~
#>  8      768    0.0175 TGTGCGAGATTTTTCCATGA~ CARFF~ IGHV~ IGHD~ IGHJ~ IGHG3 asse~
#>  9      701    0.0172 TGCCAGTCCTATGACAGCAG~ CQSYD~ IGLV~ .     IGLJ~ IGLC  asse~
#> 10      628    0.0143 TGTGCGAGAGATGTACTATT~ CARDV~ IGHV~ IGHD~ IGHJ~ IGHG1 asse~
#> # ... with 6,017 more rows, and 1 more variable: cid_full_length <dbl>

Tidy up the clonotype dataframes

The tidy-up consists of four steps, namely four functions:

  1. format_clonotype_to_immunarch_style
  2. remove_nonproductive_CDR3aa
  3. annotate_chain_name_and_isotype_name
  4. merge_convergent_clonotype
# If you only want to test one sample, you can process the only sample as follows.
the_divergent_clonotype_dataframe <- raw_clonotype_dataframe_list[["sample_01"]] %>%
    format_clonotype_to_immunarch_style(., clonotyping_tool = present_tool) %>%
    remove_nonproductive_CDR3aa %>%
    annotate_chain_name_and_isotype_name %>%
    merge_convergent_clonotype

# Then the only one sample should be put into a list, element of which uses the sample name,
# because the later step need a named list of data frames as input.
divergent_clonotype_dataframe_list <- list(sample_01 = the_divergent_clonotype_dataframe)

# Otherwise, normally you will have multiple samples,
# then functional style of processing is preferred as follows.
divergent_clonotype_dataframe_list <- raw_clonotype_dataframe_list %>%
    lapply(., format_clonotype_to_immunarch_style, clonotyping_tool = present_tool) %>%
    lapply(., remove_nonproductive_CDR3aa) %>%
    lapply(., annotate_chain_name_and_isotype_name) %>%
    lapply(., merge_convergent_clonotype)

Calculate and merge repertoire metrics by chains for each sample in the list

This step consists of three functions.

# handle repertoire metrics for all the chains.
all_sample_all_chain_all_metrics_wide_format_dataframe_list <- the_divergent_clonotype_dataframe_list %>%
    lapply(., compute_repertoire_metrics_by_chain_name)

all_sample_all_chain_all_metrics_wide_format_dataframe_list
#> $sample_01
#>     diversity  clonality richness  evenness       median
#> IGH 5.4161872 0.26283295     1552 0.7371670 0.0001509510
#> IGK 5.2677388 0.28931127     1656 0.7106887 0.0000908224
#> IGL 4.8949171 0.25490053      713 0.7450995 0.0004132231
#> TRA 4.3018929 0.06585582      100 0.9341442 0.0064377682
#> TRB 4.8358496 0.08467479      197 0.9153252 0.0036429872
#> TRD 0.6730117 0.02904941        2 0.9709506 0.5000000000
#> TRG 0.6931472 0.00000000        2 1.0000000 0.5000000000
#> 
#> $sample_02
#>     diversity  clonality richness  evenness       median
#> IGH 5.3401961 0.28075859     1677 0.7192414 9.231905e-05
#> IGK 4.5087736 0.40269721     1898 0.5973028 4.043917e-05
#> IGL 4.7761543 0.28333416      784 0.7166658 1.851338e-04
#> TRA 3.7682140 0.07196974       58 0.9280303 1.398601e-02
#> TRB 3.8933793 0.11402336       81 0.8859766 9.174312e-03
#> TRD 0.5004024 0.27807191        2 0.7219281 5.000000e-01
#> TRG        NA         NA       NA        NA           NA
#> 
#> $sample_03
#>     diversity clonality richness  evenness       median
#> IGH 3.3401373 0.5400036     1424 0.4599964 1.032684e-04
#> IGK 5.4716100 0.1767547      770 0.8232453 4.581552e-04
#> IGL 2.5747289 0.6218047      905 0.3781953 6.578731e-05
#> TRA 4.0981274 0.1194323      105 0.8805677 5.917160e-03
#> TRB 3.9120015 0.2282353      159 0.7717647 2.816901e-03
#> TRD        NA        NA       NA        NA           NA
#> TRG 0.5982696 0.1368794        2 0.8631206 5.000000e-01

all_sample_all_chain_all_metrics_wide_format_dataframe <- all_sample_all_chain_all_metrics_wide_format_dataframe_list %>%
    combine_all_sample_repertoire_metrics

all_sample_all_chain_all_metrics_wide_format_dataframe
#>    sample_name item_name diversity  clonality richness  evenness       median
#> 1    sample_01       IGH 5.4161872 0.26283295     1552 0.7371670 1.509510e-04
#> 2    sample_01       IGK 5.2677388 0.28931127     1656 0.7106887 9.082240e-05
#> 3    sample_01       IGL 4.8949171 0.25490053      713 0.7450995 4.132231e-04
#> 4    sample_01       TRA 4.3018929 0.06585582      100 0.9341442 6.437768e-03
#> 5    sample_01       TRB 4.8358496 0.08467479      197 0.9153252 3.642987e-03
#> 6    sample_01       TRD 0.6730117 0.02904941        2 0.9709506 5.000000e-01
#> 7    sample_01       TRG 0.6931472 0.00000000        2 1.0000000 5.000000e-01
#> 8    sample_02       IGH 5.3401961 0.28075859     1677 0.7192414 9.231905e-05
#> 9    sample_02       IGK 4.5087736 0.40269721     1898 0.5973028 4.043917e-05
#> 10   sample_02       IGL 4.7761543 0.28333416      784 0.7166658 1.851338e-04
#> 11   sample_02       TRA 3.7682140 0.07196974       58 0.9280303 1.398601e-02
#> 12   sample_02       TRB 3.8933793 0.11402336       81 0.8859766 9.174312e-03
#> 13   sample_02       TRD 0.5004024 0.27807191        2 0.7219281 5.000000e-01
#> 14   sample_02       TRG        NA         NA       NA        NA           NA
#> 15   sample_03       IGH 3.3401373 0.54000361     1424 0.4599964 1.032684e-04
#> 16   sample_03       IGK 5.4716100 0.17675466      770 0.8232453 4.581552e-04
#> 17   sample_03       IGL 2.5747289 0.62180471      905 0.3781953 6.578731e-05
#> 18   sample_03       TRA 4.0981274 0.11943225      105 0.8805677 5.917160e-03
#> 19   sample_03       TRB 3.9120015 0.22823526      159 0.7717647 2.816901e-03
#> 20   sample_03       TRD        NA         NA       NA        NA           NA
#> 21   sample_03       TRG 0.5982696 0.13687943        2 0.8631206 5.000000e-01

all_sample_all_chain_individual_metrics_dataframe_list <- all_sample_all_chain_all_metrics_wide_format_dataframe %>%
    get_item_name_x_sample_name_for_each_metric

all_sample_all_chain_individual_metrics_dataframe_list
#> $diversity
#>     sample_01 sample_02 sample_03
#> IGH 5.4161872 5.3401961 3.3401373
#> IGK 5.2677388 4.5087736 5.4716100
#> IGL 4.8949171 4.7761543 2.5747289
#> TRA 4.3018929 3.7682140 4.0981274
#> TRB 4.8358496 3.8933793 3.9120015
#> TRD 0.6730117 0.5004024        NA
#> TRG 0.6931472        NA 0.5982696
#> 
#> $clonality
#>      sample_01  sample_02 sample_03
#> IGH 0.26283295 0.28075859 0.5400036
#> IGK 0.28931127 0.40269721 0.1767547
#> IGL 0.25490053 0.28333416 0.6218047
#> TRA 0.06585582 0.07196974 0.1194323
#> TRB 0.08467479 0.11402336 0.2282353
#> TRD 0.02904941 0.27807191        NA
#> TRG 0.00000000         NA 0.1368794
#> 
#> $richness
#>     sample_01 sample_02 sample_03
#> IGH      1552      1677      1424
#> IGK      1656      1898       770
#> IGL       713       784       905
#> TRA       100        58       105
#> TRB       197        81       159
#> TRD         2         2        NA
#> TRG         2        NA         2
#> 
#> $evenness
#>     sample_01 sample_02 sample_03
#> IGH 0.7371670 0.7192414 0.4599964
#> IGK 0.7106887 0.5973028 0.8232453
#> IGL 0.7450995 0.7166658 0.3781953
#> TRA 0.9341442 0.9280303 0.8805677
#> TRB 0.9153252 0.8859766 0.7717647
#> TRD 0.9709506 0.7219281        NA
#> TRG 1.0000000        NA 0.8631206
#> 
#> $median
#>        sample_01    sample_02    sample_03
#> IGH 0.0001509510 9.231905e-05 1.032684e-04
#> IGK 0.0000908224 4.043917e-05 4.581552e-04
#> IGL 0.0004132231 1.851338e-04 6.578731e-05
#> TRA 0.0064377682 1.398601e-02 5.917160e-03
#> TRB 0.0036429872 9.174312e-03 2.816901e-03
#> TRD 0.5000000000 5.000000e-01           NA
#> TRG 0.5000000000           NA 5.000000e-01

Calculate and merge repertoire metrics by IGH isotypes for each sample in the list

This step consists of three functions.

# handle repertoire metrics all all the isotypes of IGH chain.
all_sample_IGH_chain_all_metrics_wide_format_dataframe_list <- the_divergent_clonotype_dataframe_list %>%
    lapply(., calculate_IGH_isotype_proportion)

all_sample_IGH_chain_all_metrics_wide_format_dataframe_list
#> $sample_01
#>      count   proportion
#> IGHA   202 0.1828054299
#> IGHD     1 0.0009049774
#> IGHG   813 0.7357466063
#> IGHM    89 0.0805429864
#> 
#> $sample_02
#>      count   proportion
#> IGHA    11 0.0080941869
#> IGHD     1 0.0007358352
#> IGHG  1074 0.7902869757
#> IGHM   273 0.2008830022
#> 
#> $sample_03
#>      count  proportion
#> IGHA   416 0.343517754
#> IGHD     4 0.003303055
#> IGHG   775 0.639966969
#> IGHM    16 0.013212221

all_sample_IGH_chain_all_metrics_wide_format_dataframe <- all_sample_IGH_chain_all_metrics_wide_format_dataframe_list %>%
    combine_all_sample_repertoire_metrics

all_sample_IGH_chain_all_metrics_wide_format_dataframe
#>    sample_name item_name count   proportion
#> 1    sample_01      IGHA   202 0.1828054299
#> 2    sample_01      IGHD     1 0.0009049774
#> 3    sample_01      IGHG   813 0.7357466063
#> 4    sample_01      IGHM    89 0.0805429864
#> 5    sample_02      IGHA    11 0.0080941869
#> 6    sample_02      IGHD     1 0.0007358352
#> 7    sample_02      IGHG  1074 0.7902869757
#> 8    sample_02      IGHM   273 0.2008830022
#> 9    sample_03      IGHA   416 0.3435177539
#> 10   sample_03      IGHD     4 0.0033030553
#> 11   sample_03      IGHG   775 0.6399669694
#> 12   sample_03      IGHM    16 0.0132122213

all_sample_IGH_chain_individual_metrics_dataframe_list <- all_sample_IGH_chain_all_metrics_wide_format_dataframe %>%
    get_item_name_x_sample_name_for_each_metric

all_sample_IGH_chain_individual_metrics_dataframe_list
#> $count
#>      sample_01 sample_02 sample_03
#> IGHA       202        11       416
#> IGHD         1         1         4
#> IGHG       813      1074       775
#> IGHM        89       273        16
#> 
#> $proportion
#>         sample_01    sample_02   sample_03
#> IGHA 0.1828054299 0.0080941869 0.343517754
#> IGHD 0.0009049774 0.0007358352 0.003303055
#> IGHG 0.7357466063 0.7902869757 0.639966969
#> IGHM 0.0805429864 0.2008830022 0.013212221

Clonotype repertoire metrics formulas

The repertoire metrics formula including richness, diversity (Shannon entropy), evenness (Pielou’s eveness), clonality, and median (frequency median) were defined as follows, where p_i is the frequency of {\rm clonotype}_i in a sample with N unique clonotypes (Khunger, Rytlewski et al. 2019, Looney, Topacio-Hall et al. 2020). P is the frequency vector of unique clonotypes in a sample.

richness\ =\ N

Shannon\ entropy=-\sum_{i=1}^{N}{p_i\log_2{\left(p_i\right)}}

Pielou\prime s\ eveness\ =\ \frac{Shannon\ entropy}{\log_2{N}}

clonality\ =\ 1\ -\ Pielou\prime s\ evenness

frequency\ median\ =\ median(P)

The function calculate_repertoire_metrics is essential to implement the repertoire metrics formulas

calculate_repertoire_metrics
#> function (named_species_vector) 
#> {
#>     stopifnot(!duplicated(names(named_species_vector)))
#>     species_vector <- named_species_vector
#>     frequency_vector <- species_vector/sum(species_vector)
#>     shannon_entropy <- -sum(frequency_vector * log(frequency_vector), 
#>         na.rm = TRUE)
#>     richness_count <- length(species_vector)
#>     pielou_evenness <- shannon_entropy/log(richness_count)
#>     clonality_score <- 1 - pielou_evenness
#>     frequency_median <- median(frequency_vector)
#>     output_vector <- c(shannon_entropy, clonality_score, richness_count, 
#>         pielou_evenness, frequency_median)
#>     names(output_vector) <- c("diversity", "clonality", "richness", 
#>         "evenness", "median")
#>     output_vector
#> }
#> <bytecode: 0x00000000285ad120>
#> <environment: namespace:rTCRBCRr>

Acknowledgements

The hexagon logo of the package was created with the help of the package hexSticker. The math formula was written with the help of recognition tool MyScript. The latex formula in markdown was inspired by rmd4sci. The code in this study was inspired by the UCSB R tutorial note, LymphoSeq script, and vegan package.

Reference manual

It appears you don't have a PDF plugin for this browser. You can click here to download the reference manual.

install.packages("rTCRBCRr")

0.1.1 by Lizhong Ding, 4 years ago


Browse source code at https://github.com/cran/rTCRBCRr


Authors: Lizhong Ding [aut, cre]


Documentation:   PDF Manual  


MIT + file LICENSE license


Imports magrittr, readr, tidyr, tidyselect

Suggests rmarkdown, knitr


See at CRAN